perl.perl6.users

perl.perl6.users http://www.nntp.perl.org/group/perl.perl6.users/ ... Copyright 1998-2013 perl.org Sun, 19 May 2013 09:14:28 +0000 ask@perl.org Re: Per-Object Roles.. by Frank White thanks for the info Carl. Unless you really have tight memory constraints, I think this solution is fine. Cheers, Frank On Mon, Mar 4, 2013 at 3:04 PM, Carl Mäsak <cmasak@gmail.com> wrote: > Frank (>>), Moritz (>): > >> Hi, I am new to Perl6 and I'm interested in the feature that allows you > to > >> add roles to classes. From what I understand you can add a role to an > >> object using the "does" keyword. Is there any way you can remove a > role or > > > > No, you cannot remove roles. > > However, if you want an un-adorned object later, just use infix:<but>, > and keep the original object around. > > class C { > has $.name = "original"; > } > > role W { > method name { "wrapped" } > } > > my $original = C.new; > { > my $wrapped = $original but W; > say $wrapped.name; # "wrapped" > say $wrapped ~~ W; # True > } > say $original.name; # "original" > say $original ~~ W; # False > > // Carl > http://www.nntp.perl.org/group/perl.perl6.users/2013/04/msg1684.html Thu, 25 Apr 2013 02:12:00 +0000 Algebraic Data Type module for perl6 by Timo Paulssen I'm crossposting this from perl.perl6.language, because I feel this place is more appropriate. Since that mail was written, an ADT module has been added to modules.perl6.org, it's hosted in this github repository: https://github.com/timo/ADT/ Looking forward to comments as well as issues and pull requests on github. -- snip -- On 21.03.2013 17:45, Carl Mäsak wrote: > [...] > > Using hashes and subclasses: <https://gist.github.com/masak/5213423> Using > classes and subclasses: <https://gist.github.com/masak/5213563> > > [...] I came up with a prototype to create those classes like in the second gist automatically by supplying a haskell-like declaration of the data type. (skip to the end of the mail for the code) Here's what it can do: my %res = create_adt("Tree = Branch Tree left, Tree right | Leaf Str storage"); my \Tree = %res<Tree>; # create the tree with named parameters my $t = Tree.new-branch( :left(Tree.new-branch( :left(Tree.new-leaf(:storage(1))), :right(Tree.new-leaf(:storage(2))))), :right(Tree.new-leaf(:storage(3)))); # create the tree with positional arguments my $t2 = Tree.new-branch( Tree.new-branch( Tree.new-leaf(1), Tree.new-leaf(2)), Tree.new-leaf(3)); say $t2.gist; # outputs: (reformatted for email) # Tree.new-branch( # left => Tree.new-branch( # left => Tree.new-leaf(storage => 1), # right => Tree.new-leaf(storage => 2)), # right => Tree.new-leaf(storage => 3)) my \Branch = %res<Branch>; my \Leaf = %res<Leaf>; # haskell-style map for the tree sub treemap($t, *&code) { given $t { when Branch { return Tree.new-branch( treemap($t.left, &code), treemap($t.right, &code)) } when Leaf { return Tree.new-leaf(code($t.storage)) } } } say treemap($t2, * * 10).gist; # outputs: # Tree.new-branch( # left => Tree.new-branch( # left => Tree.new-leaf(storage => 10), # right => Tree.new-leaf(storage => 20)), # right => Tree.new-leaf(storage => 30)) There are currently some limitations: 1) there is no compiler support for checking that all cases have been covered, but as masak mentioned, I'm confident this can be done with a macro, because those run at compile-time basically. 2) you cannot yet use Leaf and Branch for declaring multi subs, because the symbols are not there at compile-time, but see below. 3) I have not yet figured out how to properly do pattern matching/decomposing, so the names "left", "right" and "storage" need to be supplied in the definition unlike in haskell. 4) I'm not sure how to do type parameters (think data Tree A = ...), because perl6 has only parametric roles, not parametric classes. One thing rakudo needs to get for this to be much smoother is support for the sub EXPORT to return a hash-like of symbols that will be installed in the caller's package. This would make Tree, Branch and Leaf available as compile-time symbols, so that multi methods/subs can use them for dispatch. I mean to turn this into a module for the perl6 modules list some time in the Future. Finally, here's the runnable code. Feel free to play around with it and tell me on this mailing list or the IRC channel what further problems (or even solutions!) you find. https://gist.github.com/timo/5226114 Have Fun! - Timo http://www.nntp.perl.org/group/perl.perl6.users/2013/04/msg1683.html Tue, 02 Apr 2013 04:06:37 +0000 Algebraic Data Types in perl6 by Timo Paulssen Hey perl6 people, I'm crossposting this message from perl.perl6.language, because I feel it's more appropriate here. User phiroc@free.fr had asked if ADT and GADT will be available in perl6 any time soon, Carl Mäsak implemented two suggestions (see quoted text below) and I implemented it as a POC and then as a module. The module code now lives on github here: https://github.com/timo/ADT/ and is also available to be panda-installed from modules.perl6.org I'm looking forward to hearing your comments as well as your issues and pull requests on github :) - Timo ---- 8< ---- On 21.03.2013 17:45, Carl Mäsak wrote: > [...] > > Using hashes and subclasses: <https://gist.github.com/masak/5213423> Using > classes and subclasses: <https://gist.github.com/masak/5213563> > > [...] I came up with a prototype to create those classes like in the second gist automatically by supplying a haskell-like declaration of the data type. (skip to the end of the mail for the code) Here's what it can do: my %res = create_adt("Tree = Branch Tree left, Tree right | Leaf Str storage"); my \Tree = %res<Tree>; # create the tree with named parameters my $t = Tree.new-branch( :left(Tree.new-branch( :left(Tree.new-leaf(:storage(1))), :right(Tree.new-leaf(:storage(2))))), :right(Tree.new-leaf(:storage(3)))); # create the tree with positional arguments my $t2 = Tree.new-branch( Tree.new-branch( Tree.new-leaf(1), Tree.new-leaf(2)), Tree.new-leaf(3)); say $t2.gist; # outputs: (reformatted for email) # Tree.new-branch( # left => Tree.new-branch( # left => Tree.new-leaf(storage => 1), # right => Tree.new-leaf(storage => 2)), # right => Tree.new-leaf(storage => 3)) my \Branch = %res<Branch>; my \Leaf = %res<Leaf>; # haskell-style map for the tree sub treemap($t, *&code) { given $t { when Branch { return Tree.new-branch( treemap($t.left, &code), treemap($t.right, &code)) } when Leaf { return Tree.new-leaf(code($t.storage)) } } } say treemap($t2, * * 10).gist; # outputs: # Tree.new-branch( # left => Tree.new-branch( # left => Tree.new-leaf(storage => 10), # right => Tree.new-leaf(storage => 20)), # right => Tree.new-leaf(storage => 30)) There are currently some limitations: 1) there is no compiler support for checking that all cases have been covered, but as masak mentioned, I'm confident this can be done with a macro, because those run at compile-time basically. 2) you cannot yet use Leaf and Branch for declaring multi subs, because the symbols are not there at compile-time, but see below. 3) I have not yet figured out how to properly do pattern matching/decomposing, so the names "left", "right" and "storage" need to be supplied in the definition unlike in haskell. 4) I'm not sure how to do type parameters (think data Tree A = ...), because perl6 has only parametric roles, not parametric classes. One thing rakudo needs to get for this to be much smoother is support for the sub EXPORT to return a hash-like of symbols that will be installed in the caller's package. This would make Tree, Branch and Leaf available as compile-time symbols, so that multi methods/subs can use them for dispatch. I mean to turn this into a module for the perl6 modules list some time in the Future. Finally, here's the runnable code. Feel free to play around with it and tell me on this mailing list or the IRC channel what further problems (or even solutions!) you find. https://gist.github.com/timo/5226114 Have Fun! - Timo http://www.nntp.perl.org/group/perl.perl6.users/2013/04/msg1682.html Mon, 01 Apr 2013 16:56:39 +0000 Re: Packaging Perl 6 (or rather, Rakudo Star) by Moritz Lenz On 03/05/2013 12:02 PM, Rob Hoelz wrote: > On 3/5/13 11:44 AM, Patrick R. Michaud wrote: >> On Tue, Mar 05, 2013 at 11:13:51AM +0100, Rob Hoelz wrote: >>> I already have my own package for Arch Linux for Rakudo Star, and I keep >>> the OS X homebrew package up-to-date as well. I'd like to create an RPM >>> spec file and a DEB spec file as well. I have two questions: >>> >>> 1) Do these spec files belong in the Rakudo Star repository? >> I have no problem with maintaining spec files in any of the >> Rakudo-related repos (NQP, Rakudo, Star). >> >>> 2) Which makes more sense: having a Rakudo Star package that depends on >>> a separate Rakudo package (so Rakudo Star would only consist of modules >>> and applications), or having a Rakudo Star package that conflicts with a >>> separate Rakudo package (so users may install one or the other)? [...] >> I suspect to ever be considered for official inclusion in Debian/Ubuntu >> distros, you'd have to have the first option (separate compiler and >> module packages). And moreso: they likely prefer to see each module >> as its own package, rather than a single package containing a complete >> collection of modules. (I think module collections in the .deb world >> tend to be managed as packages with dependencies, as opposed to >> all-in-one packages.) > > That's a good point; that's probably the proper way to do things. Now > to make that happen... >> >> It may also be worth noting/reminding that Rakudo Star has never been >> intended to be the "only" or even "primary" module collection, it's just >> one of the first. It could make good sense to come up with a new >> P6 distribution that is better tailored to the needs of OS distros. > > Another good point; should we hold off on making packages for Rakudo > Star until something more appropriate comes along, or should we go > ahead and make some packages? I would favor the latter, myself. I think a good idea is to start packaging Rakudo, panda, perl6-debug and the various modules. And if/when all of the modules in Star are packaged, you can make a sort of meta package that depends on them all, and call it 'rakudo-star'. That's a bit of a bottom-up approach, which worked well in other areas of Perl 6 development. Cheers, Moritz http://www.nntp.perl.org/group/perl.perl6.users/2013/03/msg1681.html Wed, 06 Mar 2013 02:01:21 +0000 Re: Packaging Perl 6 (or rather, Rakudo Star) by Parrot Raiser On Tue, Mar 5, 2013 at 6:07 AM, Patrick R. Michaud <pmichaud@pobox.com> wrote: > > Same here. I think "something more appropriate" is much more likely to > arrive with the "go ahead and make" approach than the "hold off" one. :) > I agree with Patrick. Experimenting with the packaging now should flush out the bugs before people seriously expect it to "Just Work". Beta testers are much less likely to get upset if something doesn't, than users who really wanted to have something in production yesterday. Before that day arrives, I think there's some work to be done on the perceived lag when Perl 6 is invoked. It's still noticeable, even on a fairly fast machine. http://www.nntp.perl.org/group/perl.perl6.users/2013/03/msg1680.html Tue, 05 Mar 2013 14:58:38 +0000 Re: Packaging Perl 6 (or rather, Rakudo Star) by Patrick R. Michaud On Tue, Mar 05, 2013 at 12:02:01PM +0100, Rob Hoelz wrote: > On 3/5/13 11:44 AM, Patrick R. Michaud wrote: > > It may also be worth noting/reminding that Rakudo Star has never been > > intended to be the "only" or even "primary" module collection, it's just > > one of the first. It could make good sense to come up with a new > > P6 distribution that is better tailored to the needs of OS distros. > > Another good point; should we hold off on making packages for Rakudo > Star until something more appropriate comes along, or should we go > ahead and make some packages? I would favor the latter, myself. Same here. I think "something more appropriate" is much more likely to arrive with the "go ahead and make" approach than the "hold off" one. :) Pm http://www.nntp.perl.org/group/perl.perl6.users/2013/03/msg1679.html Tue, 05 Mar 2013 11:07:16 +0000 Re: Packaging Perl 6 (or rather, Rakudo Star) by Rob Hoelz On 3/5/13 11:44 AM, Patrick R. Michaud wrote: > On Tue, Mar 05, 2013 at 11:13:51AM +0100, Rob Hoelz wrote: >> I already have my own package for Arch Linux for Rakudo Star, and I keep >> the OS X homebrew package up-to-date as well. I'd like to create an RPM >> spec file and a DEB spec file as well. I have two questions: >> >> 1) Do these spec files belong in the Rakudo Star repository? > I have no problem with maintaining spec files in any of the > Rakudo-related repos (NQP, Rakudo, Star). > >> 2) Which makes more sense: having a Rakudo Star package that depends on >> a separate Rakudo package (so Rakudo Star would only consist of modules >> and applications), or having a Rakudo Star package that conflicts with a >> separate Rakudo package (so users may install one or the other)? [...] > I suspect to ever be considered for official inclusion in Debian/Ubuntu > distros, you'd have to have the first option (separate compiler and > module packages). And moreso: they likely prefer to see each module > as its own package, rather than a single package containing a complete > collection of modules. (I think module collections in the .deb world > tend to be managed as packages with dependencies, as opposed to > all-in-one packages.) That's a good point; that's probably the proper way to do things. Now to make that happen... > > It may also be worth noting/reminding that Rakudo Star has never been > intended to be the "only" or even "primary" module collection, it's just > one of the first. It could make good sense to come up with a new > P6 distribution that is better tailored to the needs of OS distros. Another good point; should we hold off on making packages for Rakudo Star until something more appropriate comes along, or should we go ahead and make some packages? I would favor the latter, myself. -Rob http://www.nntp.perl.org/group/perl.perl6.users/2013/03/msg1678.html Tue, 05 Mar 2013 11:00:58 +0000 Re: Packaging Perl 6 (or rather, Rakudo Star) by Patrick R. Michaud On Tue, Mar 05, 2013 at 11:13:51AM +0100, Rob Hoelz wrote: > I already have my own package for Arch Linux for Rakudo Star, and I keep > the OS X homebrew package up-to-date as well. I'd like to create an RPM > spec file and a DEB spec file as well. I have two questions: > > 1) Do these spec files belong in the Rakudo Star repository? I have no problem with maintaining spec files in any of the Rakudo-related repos (NQP, Rakudo, Star). > 2) Which makes more sense: having a Rakudo Star package that depends on > a separate Rakudo package (so Rakudo Star would only consist of modules > and applications), or having a Rakudo Star package that conflicts with a > separate Rakudo package (so users may install one or the other)? [...] I suspect to ever be considered for official inclusion in Debian/Ubuntu distros, you'd have to have the first option (separate compiler and module packages). And moreso: they likely prefer to see each module as its own package, rather than a single package containing a complete collection of modules. (I think module collections in the .deb world tend to be managed as packages with dependencies, as opposed to all-in-one packages.) It may also be worth noting/reminding that Rakudo Star has never been intended to be the "only" or even "primary" module collection, it's just one of the first. It could make good sense to come up with a new P6 distribution that is better tailored to the needs of OS distros. Pm http://www.nntp.perl.org/group/perl.perl6.users/2013/03/msg1677.html Tue, 05 Mar 2013 10:52:57 +0000 Packaging Perl 6 (or rather, Rakudo Star) by Rob Hoelz Hi everyone, There was some discussion on #perl6 yesterday on what requirements are necessary for Perl 6 to be considered "production ready", and moritz++ made a quick list (https://gist.github.com/moritz/5082925) of the top of his head including deployment in major free OSes. This is one area where I feel I could be of help, as I feel it's extremely important to have Linux/BSD packages in order to be taken seriously, and it's something that doesn't require intimate knowledge of how Rakudo works. I already have my own package for Arch Linux for Rakudo Star, and I keep the OS X homebrew package up-to-date as well. I'd like to create an RPM spec file and a DEB spec file as well. I have two questions: 1) Do these spec files belong in the Rakudo Star repository? 2) Which makes more sense: having a Rakudo Star package that depends on a separate Rakudo package (so Rakudo Star would only consist of modules and applications), or having a Rakudo Star package that conflicts with a separate Rakudo package (so users may install one or the other)? I think the former is less confusing (the latter may lead to people asking "well, which one do I install"), but the former is probably a little harder to do. -Rob http://www.nntp.perl.org/group/perl.perl6.users/2013/03/msg1676.html Tue, 05 Mar 2013 10:12:49 +0000 Re: Per-Object Roles.. by Carl Mäsak Frank (>>), Moritz (>): >> Hi, I am new to Perl6 and I'm interested in the feature that allows you to >> add roles to classes. From what I understand you can add a role to an >> object using the "does" keyword. Is there any way you can remove a role or > > No, you cannot remove roles. However, if you want an un-adorned object later, just use infix:<but>, and keep the original object around. class C { has $.name = "original"; } role W { method name { "wrapped" } } my $original = C.new; { my $wrapped = $original but W; say $wrapped.name; # "wrapped" say $wrapped ~~ W; # True } say $original.name; # "original" say $original ~~ W; # False // Carl http://www.nntp.perl.org/group/perl.perl6.users/2013/03/msg1675.html Mon, 04 Mar 2013 20:05:06 +0000 Re: hyperoperator bug? «~» != <<~>> by Carl Mäsak No, both programs are wrong, not correct. The bug is that Rakudo accepts the first one, not that it rejects the second one. The error message to the second one looks correct to me. (It tries to hash-index the list of stuff the .map generated.) <masak> r: .say for (1, 2, 3) <<~>> "!"; .say for (1, 2, 3) «~» "!"; .say for (1, 2, 3)«~»"!" <p6eval> rakudo 87ad7c: OUTPUT«1!␤2!␤3!␤1!␤2!␤3!␤1!␤2!␤3!␤» <masak> r: .say for (1, 2, 3)<<~>>"!" <p6eval> rakudo 87ad7c: OUTPUT«===SORRY!===␤Two terms in a row␤at /tmp/Kg__QjZ4yV:1␤------> .say for (1, 2, 3)<<~>>⏏"!"␤ [...] * masak submits rakudobug <jnthn> masak: It parsed as a subscript <masak> jnthn: I know. <jnthn> masak: Yes, and STD does it too. <jnthn> masak: It's not a bug. <masak> jnthn: responding to Ovid's p6u email from a week ago. <masak> jnthn: the fact that it parses as a subscript isn't the bug. <masak> jnthn: look at the evaluation before. <masak> it parses as a subscript when it's <<~>>, but not when it's «~» <jnthn> oh... <jnthn> Yeah, that's 'cus we're missing those quotes in the grammar somehow <masak> that's the bug. <jnthn> masak: OK, fair enough. // masak On Mon, Feb 25, 2013 at 11:56 AM, Ovid <curtis_ovid_poe@yahoo.com> wrote: > I was playing with this code: https://github.com/Keith-S-Thompson/fizzbuzz-polyglot/blob/master/fizzbuzz.pl6 > > [~](((1..100).map: { > $_ % 15 == 0 ?? "FizzBuzz" !! > $_ % 3 == 0 ?? "Fizz" !! > $_ % 5 == 0 ?? "Buzz" !! > $_ > })«~»("\n")).print; > > I was cleaning it up and since not everyone can type guillemets, I wound up with this: > > [~](((1..100).map: { > $_ %% 15 ?? "FizzBuzz" !! > $_ %% 3 ?? "Fizz" !! > $_ %% 5 ?? "Buzz" !! > $_ > })<<~>>("\n")).print; > > That generated this error: > > No such method 'postcircumfix:<( )>' for invocant of type 'Parcel' > in at src/gen/BOOTSTRAP.pm:852 > in any at src/gen/BOOTSTRAP.pm:836 > in block at fizzbuzz.p6:6 > > Reverting to guillemets fixes the problem. Is this a Rakudo bug or are double angle brackets not interchangeable with guillemets? > > > bin/perl6 -v > This is perl6 version 2013.01 built on parrot 4.10.0 revision 0 > > Cheers, > Ovid > -- > Twitter - http://twitter.com/OvidPerl/ > Buy my book - http://bit.ly/beginning_perl > Buy my other book - http://www.oreilly.com/catalog/perlhks/ > Live and work overseas - http://www.overseas-exile.com/ http://www.nntp.perl.org/group/perl.perl6.users/2013/03/msg1674.html Mon, 04 Mar 2013 19:56:47 +0000 Re: Per-Object Roles.. by Frank White OK Moritz... Thanks for the feedback. On Sun, Feb 24, 2013 at 2:24 AM, Moritz Lenz <moritz@faui2k3.org> wrote: > Hi Frank, > > On 02/24/2013 07:27 AM, Frank White wrote: > > Hi, I am new to Perl6 and I'm interested in the feature that allows you > to > > add roles to classes. From what I understand you can add a role to an > > object using the "does" keyword. Is there any way you can remove a role > or > > No, you cannot remove roles. > > > check to see if a role is attached to an object? > > With normal type checking: > > if $obj ~~ YourRole { > ... > } > > Cheers, > Moritz > http://www.nntp.perl.org/group/perl.perl6.users/2013/02/msg1673.html Mon, 25 Feb 2013 15:34:15 +0000 hyperoperator bug? «~» != <<~>> by Ovid I was playing with this code: https://github.com/Keith-S-Thompson/fizzbuzz-polyglot/blob/master/fizzbuzz.pl6     [~](((1..100).map: {         $_ % 15 == 0 ?? "FizzBuzz" !!         $_ %  3 == 0 ?? "Fizz" !!         $_ %  5 == 0 ?? "Buzz" !!         $_     })«~»("\n")).print;   I was cleaning it up and since not everyone can type guillemets, I wound up with this:     [~](((1..100).map: {         $_ %% 15 ?? "FizzBuzz" !!         $_ %%  3 ?? "Fizz"     !!         $_ %%  5 ?? "Buzz"     !!         $_     })<<~>>("\n")).print; That generated this error:     No such method 'postcircumfix:<( )>' for invocant of type 'Parcel'       in  at src/gen/BOOTSTRAP.pm:852       in any  at src/gen/BOOTSTRAP.pm:836       in block  at fizzbuzz.p6:6 Reverting to guillemets fixes the problem. Is this a Rakudo bug or are double angle brackets not interchangeable with guillemets?     bin/perl6 -v     This is perl6 version 2013.01 built on parrot 4.10.0 revision 0 Cheers, Ovid -- Twitter - http://twitter.com/OvidPerl/ Buy my book - http://bit.ly/beginning_perl Buy my other book - http://www.oreilly.com/catalog/perlhks/ Live and work overseas - http://www.overseas-exile.com/ http://www.nntp.perl.org/group/perl.perl6.users/2013/02/msg1672.html Mon, 25 Feb 2013 10:56:17 +0000 Announce: Rakudo Star 2013.02 released by Moritz Lenz On behalf of the Rakudo and Perl 6 development teams, I'm happy to announce the February 2013 release of "Rakudo Star", a useful and usable distribution of Perl 6. The tarball for the February 2013 release is available from <http://rakudo.org/downloads/star/>. A Windows .MSI version of Rakudo star will usually appear in the downloads area shortly after the tarball release. In the Perl 6 world, we make a distinction between the language ("Perl 6") and specific implementations of the language such as "Rakudo Perl". This Star release includes release 2013.02.1 [0] of the Rakudo Perl 6 compiler [1], version 4.10.0 of the Parrot Virtual Machine [2], and various modules, documentation, and other resources collected from the Perl 6 community. Some of the new features added to this release include: * "Did you mean ..." suggestions for symbol-not-found errors * Compile-time optimization of some cases of junctions in boolean context * IO::Socket.get now works again with non-ASCII characters * constant folding for routines marked as 'is pure' * natively typed variables and better error reporting in the REPL * speed up eqv-comparison of Bufs * warnings for useless use of (some) literals, variables and constant expressions in sink context This release also contains a range of bug fixes, improvements to error reporting and better failure modes. The following features have been deprecated or modified from previous releases due to changes in the Perl 6 specification, and are being removed or changed as follows: * .gist on a type object will return '(Typename)' instead of 'Typename()'. If you want to get the class name alone, continue to use $obj.^name * postcircumfix:<[ ]> and postcircumfix:<{ }> will become multi-subs rather than multi-methods. Both at_pos and at_key will remain methods. * Unary hyper ops currently descend into nested arrays and hashes. This will change to make them equivalent to a one-level map. * The Str.ucfirst builtin is deprecated; it will be replaced by Str.tc. * Leading whitespace in rules and under :sigspace will no longer be converted to <.ws> . For existing regexes that expect this conversion, add a <?> in front of leading whitespace to make it meta again. * The ?-quantifier on captures in regexes currently binds the capture slot to a List containing either zero or one Match objects; i.e., it is equivalent to "** 0..1". In the future, the ?-quantifier will bind the slot directly to a captured Match or to Nil. Existing code can manage the transition by changing existing ?-quantifiers to use "** 0..1", which will continue to return a List of matches. There are some key features of Perl 6 that Rakudo Star does not yet handle appropriately, although they will appear in upcoming releases. Some of the not-quite-there features include: * advanced macros * threads and concurrency * Unicode strings at levels other than codepoints * interactive readline that understands Unicode * non-blocking I/O * much of Synopsis 9 There is an online resource at http://perl6.org/compilers/features that lists the known implemented and missing features of Rakudo and other Perl 6 implementations. In many places we've tried to make Rakudo smart enough to inform the programmer that a given feature isn't implemented, but there are many that we've missed. Bug reports about missing and broken features are welcomed at <rakudobug@perl.org>. See http://perl6.org/ for links to much more information about Perl 6, including documentation, example code, tutorials, reference materials, specification documents, and other supporting resources. A draft of a Perl 6 book is available as <docs/UsingPerl6-draft.pdf> in the release tarball. The development team thanks all of the contributors and sponsors for making Rakudo Star possible. If you would like to contribute, see <http://rakudo.org/how-to-help>, ask on the perl6-compiler@perl.org mailing list, or join us on IRC #perl6 on freenode. [0] https://github.com/rakudo/rakudo/blob/nom/docs/announce/2013.01 [1] http://github.com/rakudo/rakudo [2] http://parrot.org/ http://www.nntp.perl.org/group/perl.perl6.users/2013/02/msg1671.html Sun, 24 Feb 2013 19:22:50 +0000 Re: Per-Object Roles.. by Moritz Lenz Hi Frank, On 02/24/2013 07:27 AM, Frank White wrote: > Hi, I am new to Perl6 and I'm interested in the feature that allows you to > add roles to classes. From what I understand you can add a role to an > object using the "does" keyword. Is there any way you can remove a role or No, you cannot remove roles. > check to see if a role is attached to an object? With normal type checking: if $obj ~~ YourRole { ... } Cheers, Moritz http://www.nntp.perl.org/group/perl.perl6.users/2013/02/msg1670.html Sun, 24 Feb 2013 07:24:20 +0000 Per-Object Roles.. by Frank White Hi, I am new to Perl6 and I'm interested in the feature that allows you to add roles to classes. From what I understand you can add a role to an object using the "does" keyword. Is there any way you can remove a role or check to see if a role is attached to an object? I couldn't find that in the documentation on the website. Any comments are appreciated... Thanks in advance, Frank http://www.nntp.perl.org/group/perl.perl6.users/2013/02/msg1669.html Sun, 24 Feb 2013 06:27:32 +0000 Re: Perl 6 / Rakudo unicode code point ranges by David Warring Hi Will, On Wed, Feb 20, 2013 at 3:52 AM, Will Coleda <will@coleda.com> wrote: > The code points giving you trouble are 0xFDD0..0xFDEF: > > > http://stackoverflow.com/questions/5188679/whats-the-purpose-of-the-noncharacters-ufdd0-to-ufdef > > You can split this into two ranges to avoid the problematic points (and > could use this to combine the distinct ranges you have above.) > > $ perl6 -e 'say ?("\c[0xFDCF]" ~~ > /<[\c[0xE000]..\c[0xFDCF]\c[0xFDF0]..\c[0xFFFD]]>/)' > True > Thanks for clarifying that. > > Note that if you have invalid UTF-8 input, though, you'll still get the > invalid character error, so you'll need to deal with that before trying to > use the rule. > > $ perl6 -e 'say ?("\c[0xFDD0]" ~~ > /<[\c[0xE000]..\c[0xFDCF]\c[0xFDF0]..\c[0xFFFD]]>/)' > ===SORRY!=== > Invalid character for UTF-8 encoding > > Hope this helps. > > > Yes I think so. The rule seems to be trying to step around invalid code-points; and every thing that it rejects blows up when you try to encode it anyway. So as long as I'm only parsing encoded strings, the following much simpler rule should suffice: token nonascii {<- [\x0..\x7F]>} (also using \x7F rather than \c[0x7F] - as suggested) Thanks, - David > On Mon, Feb 18, 2013 at 11:29 PM, David Warring <david.warring@gmail.com>wrote: > >> Hi Guys, >> A quick question. >> >> I'm trying to interpret unicode code-point ranges from the CSS 3 spec - >> http://www.w3.org/TR/css3-syntax/#CHARSETS >> >> The rule in question is >> >> nonascii :== #x80-#xD7FF #xE000-#xFFFD #x10000-#x10FFFF >> >> Where (I think) these are unicode code-point ranges. >> >> The latest rakudo build is fine with: >> >> >> % perl6 -e perl6 -e '/<[\c[0x80]..\c[0xD7FF]]>/' >> >> >> ...but doesn't like the second (or third) range: >> >> >> % perl6 -e '/<[\c[0xE000]..\c[0xFFFD]]>/' >> ===SORRY!=== >> Invalid character for UTF-8 encoding >> >> >> ...the individual code points are ok: >> >> >> % perl6 -e '/<[\c[0xE000]]>/' >> % perl6 -e '/<[\c[0xFFFD]]>/' >> >> >> I'm think I'm getting the above error because not all unicode code-points >> are defined for the range xE000 to xFFFD - see >> http://www.utf8-chartable.de/unicode-utf8-table.pl . >> >> I'm just having a problem implementing a concise regex/grammar rule for >> the >> above. Looking for advice. >> >> Cheers, >> David Warring >> > > > > -- > Will "Coke" Coleda > http://www.nntp.perl.org/group/perl.perl6.users/2013/02/msg1668.html Wed, 20 Feb 2013 22:56:23 +0000 Re: Perl 6 / Rakudo unicode code point ranges by Larry Wall In addition what Will said, you don't have to write \c[0xFFFD], since \xFFFD should do the same. Larry http://www.nntp.perl.org/group/perl.perl6.users/2013/02/msg1667.html Wed, 20 Feb 2013 19:29:40 +0000 Re: Perl 6 / Rakudo unicode code point ranges by Will Coleda The code points giving you trouble are 0xFDD0..0xFDEF: http://stackoverflow.com/questions/5188679/whats-the-purpose-of-the-noncharacters-ufdd0-to-ufdef You can split this into two ranges to avoid the problematic points (and could use this to combine the distinct ranges you have above.) $ perl6 -e 'say ?("\c[0xFDCF]" ~~ /<[\c[0xE000]..\c[0xFDCF]\c[0xFDF0]..\c[0xFFFD]]>/)' True Note that if you have invalid UTF-8 input, though, you'll still get the invalid character error, so you'll need to deal with that before trying to use the rule. $ perl6 -e 'say ?("\c[0xFDD0]" ~~ /<[\c[0xE000]..\c[0xFDCF]\c[0xFDF0]..\c[0xFFFD]]>/)' ===SORRY!=== Invalid character for UTF-8 encoding Hope this helps. On Mon, Feb 18, 2013 at 11:29 PM, David Warring <david.warring@gmail.com>wrote: > Hi Guys, > A quick question. > > I'm trying to interpret unicode code-point ranges from the CSS 3 spec - > http://www.w3.org/TR/css3-syntax/#CHARSETS > > The rule in question is > > nonascii :== #x80-#xD7FF #xE000-#xFFFD #x10000-#x10FFFF > > Where (I think) these are unicode code-point ranges. > > The latest rakudo build is fine with: > > > % perl6 -e perl6 -e '/<[\c[0x80]..\c[0xD7FF]]>/' > > > ...but doesn't like the second (or third) range: > > > % perl6 -e '/<[\c[0xE000]..\c[0xFFFD]]>/' > ===SORRY!=== > Invalid character for UTF-8 encoding > > > ...the individual code points are ok: > > > % perl6 -e '/<[\c[0xE000]]>/' > % perl6 -e '/<[\c[0xFFFD]]>/' > > > I'm think I'm getting the above error because not all unicode code-points > are defined for the range xE000 to xFFFD - see > http://www.utf8-chartable.de/unicode-utf8-table.pl . > > I'm just having a problem implementing a concise regex/grammar rule for the > above. Looking for advice. > > Cheers, > David Warring > -- Will "Coke" Coleda http://www.nntp.perl.org/group/perl.perl6.users/2013/02/msg1666.html Tue, 19 Feb 2013 16:52:53 +0000 Perl 6 / Rakudo unicode code point ranges by David Warring Hi Guys, A quick question. I'm trying to interpret unicode code-point ranges from the CSS 3 spec - http://www.w3.org/TR/css3-syntax/#CHARSETS The rule in question is nonascii :== #x80-#xD7FF #xE000-#xFFFD #x10000-#x10FFFF Where (I think) these are unicode code-point ranges. The latest rakudo build is fine with: % perl6 -e perl6 -e '/<[\c[0x80]..\c[0xD7FF]]>/' ...but doesn't like the second (or third) range: % perl6 -e '/<[\c[0xE000]..\c[0xFFFD]]>/' ===SORRY!=== Invalid character for UTF-8 encoding ...the individual code points are ok: % perl6 -e '/<[\c[0xE000]]>/' % perl6 -e '/<[\c[0xFFFD]]>/' I'm think I'm getting the above error because not all unicode code-points are defined for the range xE000 to xFFFD - see http://www.utf8-chartable.de/unicode-utf8-table.pl . I'm just having a problem implementing a concise regex/grammar rule for the above. Looking for advice. Cheers, David Warring http://www.nntp.perl.org/group/perl.perl6.users/2013/02/msg1665.html Tue, 19 Feb 2013 04:29:47 +0000 Re: Is there a p6doc equivalent to perltoc? by Gabor Szabo There is the index.pl in https://github.com/perl6/doc that generates the index.data file and can now list the words it found. It is a humble beginning of some indexing. regards Gabor On Fri, Feb 8, 2013 at 6:46 PM, Brian Wisti <brian.wisti@gmail.com> wrote: > Hi all, > > Is there a documentation index of some kind accessible to p6doc? I'm > thinking of something equivalent to `perldoc perltoc`. > > Kind Regards, > > Brian Wisti > > -- > Brian Wisti - a random geek > http://coolnamehere.com http://www.nntp.perl.org/group/perl.perl6.users/2013/02/msg1664.html Fri, 08 Feb 2013 20:20:57 +0000 Is there a p6doc equivalent to perltoc? by Brian Wisti Hi all, Is there a documentation index of some kind accessible to p6doc? I'm thinking of something equivalent to `perldoc perltoc`. Kind Regards, Brian Wisti -- Brian Wisti - a random geek http://coolnamehere.com http://www.nntp.perl.org/group/perl.perl6.users/2013/02/msg1663.html Fri, 08 Feb 2013 16:47:15 +0000 Rakudo Star 2013.01 released by Moritz Lenz Announce: Rakudo Star - a useful, usable, "early adopter" distribution of Perl 6 On behalf of the Rakudo and Perl 6 development teams, I'm happy to announce the January 2013 release of "Rakudo Star", a useful and usable distribution of Perl 6. The tarball for the January 2013 release is available from <http://rakudo.org/downloads/star/>. A Windows .MSI version of Rakudo star will usually appear in the downloads area shortly after the tarball release. In the Perl 6 world, we make a distinction between the language ("Perl 6") and specific implementations of the language such as "Rakudo Perl". This Star release includes release 2013.01 [0] of the Rakudo Perl 6 compiler [1], version 4.10.0 of the Parrot Virtual Machine [2], and various modules, documentation, and other resources collected from the Perl 6 community. Some of the new features added to this release include: * Sink context (what some other languages call void context) is now enforced correctly. This means that for-loops are now lazy by default. It fixes the bug where a map in sink context would not execute, and also means that a Failure returned to sink context will be properly thrown. * 'require' now works with indirect module names * Restored socket read semantics to returning the requested number of bytes * $obj.Some::Role::meth() now passes the correct $obj * try/CATCH now returns Nil when the CATCH is triggered, rather than the exception; this brings it in line with try without a CATCH * whatever-star cases of splice now implemented * can now import multis with the same name from different modules, provided all dispatchers are onlystar This release also contains a range of bug fixes, improvements to error reporting and better failure modes. The following features have been deprecated or modified from previous releases due to changes in the Perl 6 specification, and are being removed or changed as follows: * postcircumfix:<[ ]> and postcircumfix:<{ }> will become multi-subs rather than multi-methods. Both at_pos and at_key will remain methods. * Unary hyper ops currently descend into nested arrays and hashes. This will change to make them equivalent to a one-level map. * The Str.ucfirst builtin is deprecated; it will be replaced by Str.tc. * Leading whitespace in rules and under :sigspace will no longer be converted to <.ws> . For existing regexes that expect this conversion, add a <?> in front of leading whitespace to make it meta again. * The ?-quantifier on captures in regexes currently binds the capture slot to a List containing either zero or one Match objects; i.e., it is equivalent to "** 0..1". In the future, the ?-quantifier will bind the slot directly to a captured Match or to Nil. Existing code can manage the transition by changing existing ?-quantifiers to use "** 0..1", which will continue to return a List of matches. There are some key features of Perl 6 that Rakudo Star does not yet handle appropriately, although they will appear in upcoming releases. Some of the not-quite-there features include: * advanced macros * threads and concurrency * Unicode strings at levels other than codepoints * interactive readline that understands Unicode * non-blocking I/O * much of Synopsis 9 There is an online resource at http://perl6.org/compilers/features that lists the known implemented and missing features of Rakudo and other Perl 6 implementations. In many places we've tried to make Rakudo smart enough to inform the programmer that a given feature isn't implemented, but there are many that we've missed. Bug reports about missing and broken features are welcomed at <rakudobug@perl.org>. See http://perl6.org/ for links to much more information about Perl 6, including documentation, example code, tutorials, reference materials, specification documents, and other supporting resources. A draft of a Perl 6 book is available as <docs/UsingPerl6-draft.pdf> in the release tarball. The development team thanks all of the contributors and sponsors for making Rakudo Star possible. If you would like to contribute, see <http://rakudo.org/how-to-help>, ask on the perl6-compiler@perl.org mailing list, or join us on IRC #perl6 on freenode. [0] https://github.com/rakudo/rakudo/blob/nom/docs/announce/2013.01 [1] http://github.com/rakudo/rakudo [2] http://parrot.org/ http://www.nntp.perl.org/group/perl.perl6.users/2013/01/msg1662.html Wed, 30 Jan 2013 18:54:35 +0000 Re: implementing every(N) by Ted Zlatanov On Tue, 8 Jan 2013 11:29:47 -0600 "Patrick R. Michaud" <pmichaud@pobox.com> wrote: PRM> On Tue, Jan 08, 2013 at 12:14:22PM -0500, Ted Zlatanov wrote: >> >> Since I'm writing a module, I didn't think a one-liner was sufficient >> proof that state variables are reliable. Sorry I didn't make that >> clear. [...] PRM> Also, if the state variables currently behave as you expect, and we PRM> want to insure their reliability for the future, add a spectest to PRM> the "roast" suite. This way we'll also quickly discover if other PRM> Perl 6 implementations differ on this point. :-) Got it, thanks! Ted http://www.nntp.perl.org/group/perl.perl6.users/2013/01/msg1661.html Wed, 09 Jan 2013 16:13:43 +0000 Re: implementing every(N) by Patrick R. Michaud On Tue, Jan 08, 2013 at 12:14:22PM -0500, Ted Zlatanov wrote: > On Mon, 7 Jan 2013 17:51:52 +0100 Carl Mäsak <cmasak@gmail.com> wrote: > > CM> Ted (>): > >> Are state variables available now, or is the every(N) functionality > >> possible in some other way now? > > CM> Why not try it by writing a small program? :) > CM> $ perl6 -e 'sub foo { state $s = 0; say $s++ }; foo; foo; foo' > > Since I'm writing a module, I didn't think a one-liner was sufficient > proof that state variables are reliable. Sorry I didn't make that > clear. [...] Also, if the state variables currently behave as you expect, and we want to insure their reliability for the future, add a spectest to the "roast" suite. This way we'll also quickly discover if other Perl 6 implementations differ on this point. :-) Thanks! Pm http://www.nntp.perl.org/group/perl.perl6.users/2013/01/msg1660.html Tue, 08 Jan 2013 17:29:57 +0000 Re: implementing every(N) by Ted Zlatanov On Mon, 7 Jan 2013 17:51:52 +0100 Carl Mäsak <cmasak@gmail.com> wrote: CM> Ted (>): >> Are state variables available now, or is the every(N) functionality >> possible in some other way now? CM> Why not try it by writing a small program? :) CM> Rakudo is available at a discount right now -- download it before it's CM> too late! -- and the syntax for state variables is the same as it's CM> always been. The one-liner to find out is shorter than your question: CM> $ perl6 -e 'sub foo { state $s = 0; say $s++ }; foo; foo; foo' CM> 0 CM> 1 CM> 2 Thank you for the explanation. Since I'm writing a module, I didn't think a one-liner was sufficient proof that state variables are reliable. Sorry I didn't make that clear. I was worried about edge cases, and also wondered if there may be a better way to implement my proposal--I don't know Perl 6 and Rakudo well enough. It seems like state variables are best, right now. Thanks! Ted http://www.nntp.perl.org/group/perl.perl6.users/2013/01/msg1659.html Tue, 08 Jan 2013 17:14:49 +0000 Re: implementing every(N) by Carl Mäsak Ted (>): > Are state variables available now, or is the every(N) functionality > possible in some other way now? Why not try it by writing a small program? :) Rakudo is available at a discount right now -- download it before it's too late! -- and the syntax for state variables is the same as it's always been. The one-liner to find out is shorter than your question: $ perl6 -e 'sub foo { state $s = 0; say $s++ }; foo; foo; foo' 0 1 2 Regards, // Carl http://www.nntp.perl.org/group/perl.perl6.users/2013/01/msg1658.html Mon, 07 Jan 2013 16:52:00 +0000 Re: implementing every(N) by Ted Zlatanov On Fri, 30 Jul 2010 12:56:37 -0500 Ted Zlatanov <tzz@lifelogs.com> wrote: TZ> On Fri, 30 Jul 2010 12:19:16 -0500 "Patrick R. Michaud" <pmichaud@pobox.com> wrote: PRM> I suspect something like CALLER::<$?FILE> and CALLER::<$?LINE> might PRM> eventually do what you want -- they would at least get to a unique PRM> line within the calling. CALLER:: and $?FILE and $?LINE are not PRM> yet implemented in Rakudo, but I suspect the language specification PRM> has sufficient features to eventually make a clean implementation a PRM> possibility. TZ> (also suggested by Moritz with state variables as the real solution) TZ> I could have used __LINE__ in Perl 5 as well but chose not to so TZ> multiple calls to every() could be made on the same line. I'd like to TZ> provide the same functionality in Rakudo. So state variables seem like TZ> the easiest solution outside of the core and I can wait until they are TZ> available. If anyone thinks every() could go in the core or really TZ> wants to see it ported sooner let me know :) Are state variables available now, or is the every(N) functionality possible in some other way now? Thanks Ted http://www.nntp.perl.org/group/perl.perl6.users/2013/01/msg1657.html Mon, 07 Jan 2013 15:18:27 +0000 enc2xs and perl6 ? by Marc Chantreux hello guys, As i think Perl6 can be the next reference langage for data integration in libraries systems, i'm porting MARC::MIR and MARC::MIR::Template in Perl6. Well … basic things are now working when it come to UTF8 files, but i have tons of data encoded in iso5426. I would like to resuse the ucm file i wrote for perl5 (https://github.com/eiro/p5-encode-iso5426) (not shipped on cpan because of poor quality on UTF8 fallbacks). is there an existing tool/infrastructure to use this UCM file? what's the code/doc i have to read to make it real? regards marc http://www.nntp.perl.org/group/perl.perl6.users/2013/01/msg1656.html Sat, 05 Jan 2013 12:19:58 +0000 Pygments hilighter for Perl 6 by Rob Hoelz Hi everyone, For the past two weeks, I have been working on a Pygments syntax hilighter for Perl 6. It has finally reached a state where I feel it is ready to be tested by the community! If you have some Perl 6 code and some spare time, please test it out. The code is located here: https://bitbucket.org/hoelzro/pygments-main/ There are a few known issues right now, but I don't consider them significant enough to deter this announcement. Here they are: * Lines like 'regex special_variable:sym<{ }>' (ones containing an opening brace before the opening braces that signifies the start of the regex/method) don't match properly. * Some operators (like eq) are not parsed as operators. * Parameters to a token (ex. token something(@params)) are not correctly hilighted. * Adding/subtracting to/from character classes (ex. <[...] + [...]>) is not yet correctly hilighted. * role q { ... } is hilighted as a keyword and a string literal. In addition to fixing these, I intend to implement the following features: * Better type detection. Right now, a file is identified as Perl 6 if the shebang line matches 'perl6', or if 'use v6' is found. This can be improved. * Speed improvement. I haven't put any time into optimization, and this can likely be improved. If you find any bugs, or better yet, if you have any improvements to submit, please let me know! -Rob http://www.nntp.perl.org/group/perl.perl6.users/2013/01/msg1655.html Wed, 02 Jan 2013 19:11:28 +0000 Announce: Rakudo Star 2012.12 release by Moritz Lenz Announce: Rakudo Star - a useful, usable, "early adopter" distribution of Perl 6 On behalf of the Rakudo and Perl 6 development teams, I'm happy to announce the December 2012 release of "Rakudo Star", a useful and usable distribution of Perl 6. The tarball for the December 2012 release is available from <http://rakudo.org/downloads/star/>. A Windows .MSI version of Rakudo star will usually appear in the downloads area shortly after the tarball release. In the Perl 6 world, we make a distinction between the language ("Perl 6") and specific implementations of the language such as "Rakudo Perl". This Star release includes release 2012.11 [0] of the Rakudo Perl 6 compiler [1], version 4.10.0 of the Parrot Virtual Machine [2], and various modules, documentation, and other resources collected from the Perl 6 community. Some of the new features added to this release include: * Parse errors are much improved, and follow STD, the standard parser, much more closely; they are more accurate and more information is given * Rakudo now keeps parsing after some less serious errors * Better errors for various parse failures * The junction autothreader is now an order of magnitude faster * Texas (ASCII) versions of the Set and Bag operators implemented * Nested Pairs now give correct .perl output * { a => $_ } now correctly considered a block, not a hash as before This release also contains a range of performance improvements, bug fixes, improvements to error reporting and better failure modes. The following features have been deprecated or modified from previous releases due to changes in the Perl 6 specification, and are being removed or changed as follows: * 'for'-loops will become lazy, and are only evaluated eagerly in eager or sink (void) context. This means that if a for-loop is the last statement in a routine, it will usually run after the routine has returned, so it cannot call return() anymore. * Unary hyper ops currently descend into nested arrays and hashes. This will change to make them equivalent to a one-level map. * The Str.ucfirst builtin is deprecated; it will be replaced by Str.tc. * Leading whitespace in rules and under :sigspace will no longer be converted to <.ws> . For existing regexes that expect this conversion, add a <?> in front of leading whitespace to make it meta again. * The ?-quantifier on captures in regexes currently binds the capture slot to a List containing either zero or one Match objects; i.e., it is equivalent to "** 0..1". In the future, the ?-quantifier will bind the slot directly to a captured Match or to Nil. Existing code can manage the transition by changing existing ?-quantifiers to use "** 0..1", which will continue to return a List of matches. There are some key features of Perl 6 that Rakudo Star does not yet handle appropriately, although they will appear in upcoming releases. Some of the not-quite-there features include: * advanced macros * threads and concurrency * Unicode strings at levels other than codepoints * interactive readline that understands Unicode * non-blocking I/O * much of Synopsis 9 There is an online resource at http://perl6.org/compilers/features that lists the known implemented and missing features of Rakudo and other Perl 6 implementations. In many places we've tried to make Rakudo smart enough to inform the programmer that a given feature isn't implemented, but there are many that we've missed. Bug reports about missing and broken features are welcomed at <rakudobug@perl.org>. See http://perl6.org/ for links to much more information about Perl 6, including documentation, example code, tutorials, reference materials, specification documents, and other supporting resources. A draft of a Perl 6 book is available as <docs/UsingPerl6-draft.pdf> in the release tarball. The development team thanks all of the contributors and sponsors for making Rakudo Star possible. If you would like to contribute, see <http://rakudo.org/how-to-help>, ask on the perl6-compiler@perl.org mailing list, or join us on IRC #perl6 on freenode. [0] https://github.com/rakudo/rakudo/blob/nom/docs/announce/2012.12 [1] http://github.com/rakudo/rakudo [2] http://parrot.org/ http://www.nntp.perl.org/group/perl.perl6.users/2012/12/msg1654.html Thu, 27 Dec 2012 21:23:22 +0000 Rakudo Star 2012.11 released by Moritz Lenz On behalf of the Rakudo and Perl 6 development teams, I'm happy to announce the November 2012 release of "Rakudo Star", a useful and usable distribution of Perl 6. The tarball for the November 2012 release is available from <http://github.com/rakudo/star/downloads>. A Windows .MSI version of Rakudo star will usually appear in the downloads area shortly after the tarball release. In the Perl 6 world, we make a distinction between the language ("Perl 6") and specific implementations of the language such as "Rakudo Perl". This Star release includes release 2012.11 [0] of the Rakudo Perl 6 compiler [1], version 4.6.0 of the Parrot Virtual Machine [2], and various modules, documentation, and other resources collected from the Perl 6 community. Some of the new features added to this release include: * heredocs * quote adverbs (like q:w//) * implemented precedence related traits (equiv, looser, tighter, assoc) * Perl 6 grammar NFAs are pre-computed, saving some work on each invocation; this shaved around 10% off the time needed to run the spectests * regexes and quotes have better support for user-selected delimiters * FIRST/NEXT/LAST can now be used in all types of loop (previously limited to for) * several fixes related to module precompilation. This should make working with larger code bases much less painful. This release also contains a range of performance improvements, bug fixes, improvements to error reporting and better failure modes. The following features have been deprecated or modified from previous releases due to changes in the Perl 6 specification, and are being removed or changed as follows: * at present, a reference to an &foo that does not exist evalutes to Nil. This will become a CHECK-time failure, in line with STD. * Unary hyper ops currently descend into nested arrays and hashes. This will change to make them equivalent to a one-level map. * ~/.perl6/lib will go away from the default include path (@*INC). Instead %*CUSTOM_LIB now holds paths to four library locations: perl Rakudo installs its core modules here vendor OS-level package managers should install their modules here site for local module installations (e.g. with panda or ufo) home like site, but always under the user's home directory. fallback if site isn't writable. * The Str.ucfirst builtin is deprecated; it will be replaced by Str.tc. * Leading whitespace in rules and under :sigspace will no longer be converted to <.ws> . For existing regexes that expect this conversion, add a <?> in front of leading whitespace to make it meta again. * The ?-quantifier on captures in regexes currently binds the capture slot to a List containing either zero or one Match objects; i.e., it is equivalent to "** 0..1". In the future, the ?-quantifier will bind the slot directly to a captured Match or to Nil. Existing code can manage the transition by changing existing ?-quantifiers to use "** 0..1", which will continue to return a List of matches. There are some key features of Perl 6 that Rakudo Star does not yet handle appropriately, although they will appear in upcoming releases. Some of the not-quite-there features include: * advanced macros * threads and concurrency * Unicode strings at levels other than codepoints * interactive readline that understands Unicode * non-blocking I/O * much of Synopsis 9 There is an online resource at http://perl6.org/compilers/features that lists the known implemented and missing features of Rakudo and other Perl 6 implementations. In many places we've tried to make Rakudo smart enough to inform the programmer that a given feature isn't implemented, but there are many that we've missed. Bug reports about missing and broken features are welcomed at <rakudobug@perl.org>. See http://perl6.org/ for links to much more information about Perl 6, including documentation, example code, tutorials, reference materials, specification documents, and other supporting resources. A draft of a Perl 6 book is available as <docs/UsingPerl6-draft.pdf> in the release tarball. The development team thanks all of the contributors and sponsors for making Rakudo Star possible. If you would like to contribute, see <http://rakudo.org/how-to-help>, ask on the perl6-compiler@perl.org mailing list, or join us on IRC #perl6 on freenode. [0] https://github.com/rakudo/rakudo/blob/nom/docs/announce/2012.11 [1] http://github.com/rakudo/rakudo [2] http://parrot.org/ http://www.nntp.perl.org/group/perl.perl6.users/2012/11/msg1653.html Wed, 28 Nov 2012 19:41:28 +0000 Rakudo Star 2012.10 released by Jonathan Worthington On behalf of the Rakudo and Perl 6 development teams, I'm happy to announce the October 2012 release of "Rakudo Star", a useful and usable distribution of Perl 6. The tarball for the October 2012 release is available from <http://github.com/rakudo/star/downloads>. A Windows .MSI version of Rakudo star will usually appear in the downloads area shortly after the tarball release. In the Perl 6 world, we make a distinction between the language ("Perl 6") and specific implementations of the language such as "Rakudo Perl". This Star release includes release 2012.10 [0] of the Rakudo Perl 6 compiler [1], version 4.6.0 of the Parrot Virtual Machine [2], and various modules, documentation, and other resources collected from the Perl 6 community. Some of the new features added to this release include: * The method case of the handles trait * The <-> lambda, which defaults parameters to rw * The :dba modifier in regexes * The radix form :60[24, 59, 59] * Improved coverage of Perl 5 regexes when the :P5 modifier is used * Correct parsing of nested quote delimiters * Attributes in scope are now visible inside of an eval This release also contains a range of performance improvements, bug fixes, improvements to error reporting and better failure modes. The following features have been deprecated or modified from previous releases due to changes in the Perl 6 specification, and are being removed or changed as follows: * Unary hyper ops currently descend into nested arrays and hashes. This will change to make them equivalent to a one-level map. * ~/.perl6/lib will go away from the default include path (@*INC). Instead %*CUSTOM_LIB now holds paths to four library locations: perl Rakudo installs its core modules here vendor OS-level package managers should install their modules here site for local module installations (e.g. with panda or ufo) home like site, but always under the user's home directory. fallback if site isn't writable. * protos for built-in routines are now mostly as generic as possible, and will be changed to be specific to the arity of the routine. For example 'proto sub chr(|) {*}' will become 'proto sub chr($) {*}' This affects everybody who adds multis with unusual arity to built-in subs. * Parameters preceded by a | or \ can no longer have a sigil. * IO::Path.dir (which returns the directory part of the path) has been renamed to IO::Path.directory. IO::Path.dir will be removed or re-purposed. * The Str.ucfirst builtin is deprecated; it will be replaced by Str.tc. * Leading whitespace in rules and under :sigspace will no longer be converted to <.ws> . For existing regexes that expect this conversion, add a <?> in front of leading whitespace to make it meta again. * The ?-quantifier on captures in regexes currently binds the capture slot to a List containing either zero or one Match objects; i.e., it is equivalent to "** 0..1". In the future, the ?-quantifier will bind the slot directly to a captured Match or to Nil. Existing code can manage the transition by changing existing ?-quantifiers to use "** 0..1", which will continue to return a List of matches. There are some key features of Perl 6 that Rakudo Star does not yet handle appropriately, although they will appear in upcoming releases. Some of the not-quite-there features include: * advanced macros * threads and concurrency * Unicode strings at levels other than codepoints * interactive readline that understands Unicode * non-blocking I/O * much of Synopsis 9 There is an online resource at http://perl6.org/compilers/features that lists the known implemented and missing features of Rakudo and other Perl 6 implementations. In many places we've tried to make Rakudo smart enough to inform the programmer that a given feature isn't implemented, but there are many that we've missed. Bug reports about missing and broken features are welcomed at <rakudobug@perl.org>. See http://perl6.org/ for links to much more information about Perl 6, including documentation, example code, tutorials, reference materials, specification documents, and other supporting resources. A draft of a Perl 6 book is available as <docs/UsingPerl6-draft.pdf> in the release tarball. The development team thanks all of the contributors and sponsors for making Rakudo Star possible. If you would like to contribute, see <http://rakudo.org/how-to-help>, ask on the perl6-compiler@perl.org mailing list, or join us on IRC #perl6 on freenode. [0] https://github.com/rakudo/rakudo/blob/nom/docs/announce/2012.10 [1] http://github.com/rakudo/rakudo [2] http://parrot.org/ http://www.nntp.perl.org/group/perl.perl6.users/2012/11/msg1652.html Thu, 01 Nov 2012 21:31:03 +0000 Re: s:g/T/U/ doesn't work ? by Marc Chantreux hello again, i felt dumb reading your answers! it seems obvious now. thanks everyone. regards http://www.nntp.perl.org/group/perl.perl6.users/2012/10/msg1651.html Wed, 24 Oct 2012 07:34:01 +0000 Re: the nature of a scalar? by Moritz Lenz On 10/24/2012 02:46 PM, Marc Chantreux wrote: > use v6; > use lib 'lib'; > use Bailador; > > get / (.*) '/' / => sub ($path) { > $path||="foo"; $path is a subroutine parameter, and thus read-only by default. If you want to modify $path locally, write sub ($path is copy) { ... } Also if Bailador passes Match objects instead of strings into the function, $path evaluates to True in boolean context even if it matched the empty string. Cheers, Moritz http://www.nntp.perl.org/group/perl.perl6.users/2012/10/msg1650.html Wed, 24 Oct 2012 06:39:59 +0000 Re: s:g/T/U/ doesn't work ? by Jonathan Scott Duff I imagine it's the same problem as this Perl 5 code: use Test::More; for ('GATGGAACTTGACTACGTAAATT') { s/T/U/g; is $_, 'GAUGGAACUUGACUACGUAAAUU', 'RNA'; } Since $_ is an alias for each element of the list and the only element in the list is a constant string and you can't modify constants, you get the error. Changing your code to: use v6; use Test; my $x = 'GATGGAACTTGACTACGTAAATT'; for $x { s:g/T/U/; is $_ , 'GAUGGAACUUGACUACGUAAAUU' , 'RNA'; } Does indeed work. Though, if what I said is true, the error message is Less Than Awesome. I wonder could it be made more helpful? Hope this helps, -Scott On Wed, Oct 24, 2012 at 7:35 AM, Marc Chantreux <khatar@phear.org> wrote: > hello perl6 people, > > On > > This is perl6 version 2012.09.1 > built on parrot 4.6.0 revision 0 > > When i try to run > > use v6; > use Test; > for 'GATGGAACTTGACTACGTAAATT' { > s:g/T/U/; > is $_ > , 'GAUGGAACUUGACUACGUAAAUU' > , 'RNA'; > } > > I get > > Cannot assign to a non-container > in sub infix:<=> at src/gen/CORE.setting:11692 > in block at /tmp/ZZZ:4 > > As far as i understand from the doc, s:g/T/U/ is a valid syntax. any idea? > > regards > marc > http://www.nntp.perl.org/group/perl.perl6.users/2012/10/msg1649.html Wed, 24 Oct 2012 06:24:14 +0000 Re: s:g/T/U/ doesn't work ? by jerry gay On Wed, Oct 24, 2012 at 5:35 AM, Marc Chantreux <khatar@phear.org> wrote: > Cannot assign to a non-container > in sub infix:<=> at src/gen/CORE.setting:11692 > in block at /tmp/ZZZ:4 > you're attempting to modify a string constant, which cannot be modified. try something like (untested): my $snippet = 'GATGGAACTTGACTACGTAAATT'; for $snippet { ... ~jerry http://www.nntp.perl.org/group/perl.perl6.users/2012/10/msg1648.html Wed, 24 Oct 2012 06:06:37 +0000 Re: s:g/T/U/ doesn't work ? by Carl Mäsak Marc (>): > hello perl6 people, > > On > > This is perl6 version 2012.09.1 > built on parrot 4.6.0 revision 0 > > When i try to run > > use v6; > use Test; > for 'GATGGAACTTGACTACGTAAATT' { > s:g/T/U/; > is $_ > , 'GAUGGAACUUGACUACGUAAAUU' > , 'RNA'; > } > > I get > > Cannot assign to a non-container > in sub infix:<=> at src/gen/CORE.setting:11692 > in block at /tmp/ZZZ:4 > > As far as i understand from the doc, s:g/T/U/ is a valid syntax. any idea? It's valid syntax. The error you're getting is not a syntax error; it's a run-time error complaining about assigning to something that isn't a container. What you're assigning to is 'GATGGAACTTGACTACGTAAATT', a Str object. That's a bit like trying to assign to the number 5. It should produce an error, and it does. You need to put it into a variable, or an array element, or a hash value -- in short, a "container" -- for it to work. I think part of what felt confusing about this is that you did things in a 'for' loop, so the assignment directly to a Str isn't that obvious. By the way, that 'for' loop over a single element is usually spelled 'given' in Perl 6. I would write your code like this: use v6; use Test; { $_ = 'GATGGAACTTGACTACGTAAATT'; s:g/T/U/; is $_, 'GAUGGAACUUGACUACGUAAAUU', 'RNA'; } // Carl http://www.nntp.perl.org/group/perl.perl6.users/2012/10/msg1647.html Wed, 24 Oct 2012 06:05:37 +0000 the nature of a scalar? by Marc Chantreux hello perl6 people, this code says "foo", exactly as expected. use v6; my $path = ""; $path ||="foo"; say $path; I'm trying to use the same thinh in a get callback of Baildador and it doesn't work. i try to understand why is it so. use v6; use lib 'lib'; use Bailador; get / (.*) '/' / => sub ($path) { $path||="foo"; "hello ($path) ({$path.WHAT};{$path.defined}) {so $path}"; # > curl localhost:3000 # hello () (;True) True } baile; please help! regards marc http://www.nntp.perl.org/group/perl.perl6.users/2012/10/msg1646.html Wed, 24 Oct 2012 05:46:13 +0000 s:g/T/U/ doesn't work ? by Marc Chantreux hello perl6 people, On This is perl6 version 2012.09.1 built on parrot 4.6.0 revision 0 When i try to run use v6; use Test; for 'GATGGAACTTGACTACGTAAATT' { s:g/T/U/; is $_ , 'GAUGGAACUUGACUACGUAAAUU' , 'RNA'; } I get Cannot assign to a non-container in sub infix:<=> at src/gen/CORE.setting:11692 in block at /tmp/ZZZ:4 As far as i understand from the doc, s:g/T/U/ is a valid syntax. any idea? regards marc http://www.nntp.perl.org/group/perl.perl6.users/2012/10/msg1645.html Wed, 24 Oct 2012 05:36:07 +0000